Abstract: The sine cosine algorithm (SCA) is a newly emerging optimization algorithm. It is easy for sine cosine algorithm (SCA) to sink into premature of the algorithm and obtain a slower convergence ...
SSE2 implementations of sin, cos, exp, log, tan, cot, atan, atan2 The sin, cos, exp and log functions were written by Julien Pommier (see unmodified sse_mathfun.h). The tan, cot, atan, atan2 are ...
Description: 👉 Learn the basics of graphing a tangent and a cotangent function. To plot the tangent and the cotangent graph we choose a set of points and form a table of values with which we plot the ...
👉 Learn the basics of graphing a tangent and a cotangent function. To plot the tangent and the cotangent graph, we choose a set of points and form a table of values with which we plot the points on ...
Ask the publishers to restore access to 500,000+ books. An icon used to represent a menu that can be toggled by interacting with this icon. A line drawing of the Internet Archive headquarters building ...
Abstract: When chaotic systems are used in different practical applications, such as nonlinear control and cryptography, their complex chaos dynamics are strongly required. However, many existing ...
We carried out primer extension using total RNA prepared from NHK with primer 5′–ACAGTTTTGTGAGCCACCGTGTGGTTG–3′ for B2 or primer 5′–AGCAGGCTCTTTCGATCCCCAAGC–3′ for β-galactosidase as described 7. In ...
What is it? "Other Sin Improvements" builds on the demonstration in "01_Fast-Sin" of using a simple look-up table (LUT) to improve the execution time of the library sin function. These LUT examples ...